Non-PolyA Trap Vectors

PolyA Trap vectors
* Learn more about these vectors Download vector sequences


UPA Trap vector
* Learn more about these vectors Download vector sequences

NMD vectors
* Learn more about these vectors Download vector sequences

In an effort to improve the efficiency of gene trapping and increase the possibility of trapping most murine genes, we have used several different gene trap vectors in our ongoing screen. The pß-gal (from P. Soriano) and pPT1 vectors generate neomycin resistant colonies regardless of whether they insert into a gene locus because the selectable marker Neo has its own promoter and polyadenylation (pA) site. The pGT1.8-geo vector (from W.C. Skarnes) is a fusion between ß-galactosidase and neo and only gives neomycin resistant colonies if the insertion occurred in a transcriptionally active gene. It is unclear what percentage of the genome is accessible to trapping with this type of vector. The pMS1 vector (from P. Gruss) is a polyA trap vector, which is designed to trap pA sites for the Neo gene using a 3' splice donor (SD). In theory, this should increase the efficiency of the ß-gal-type vectors. The pMS1 vector also has an internal ribosome entry site (IRES) to enable reporter gene detection of trapped cell surface and secreted proteins as well as to allow reporter gene detection of trapping events that would otherwise not maintain the correct open reading frame. pGTlox2, 3 and 4 vectors are engineered to utilize the recombinase-mediated cassette exchange (RMCE) strategy. pGTlox4 uses the blasticidin resistance (bsd) gene for a selectable marker. pGT8 has an AU-rich element (ARE), which is known to mediate mRNA deadenylation and destabilization, immediately downstream of the 3' splice donor sequence which should theoretically reduce the numbers of neomycin resistant colonies that are the result of the neo gene using a cryptic pA site. Gep-SD5 is a retrovirus vector modified from P. Soriano's ROSAbgeo. The pUPA vector is from Y. Ishida (unmodified). Details on pUPA and NMDi vectors can be found in the PolyA Trapping and NMD page.
Abbreviations:
| Ad |
Human adenovirus |
| ARE |
AU-rich element |
| βactin |
β-actin promoter |
| Bcl2 |
Human B-cell lymphoma 2 |
| βgal |
β-galactosidase |
| βgeo |
β-galactosidase-neomycin resistance gene fusion |
| bsd |
Blasticidin resistance gene |
| EGFP |
Enhanced green fluorescent gene |
| En2 |
Engrail homolog 2 |
| EIF3s7 |
Eukaryotic translation initiation factor 3 subunit 7 (from exon 10 to exon 12) -- to separate the Venus stop codon from the final splice junction by more than 55nt |
| FL |
Flexible linker (alanine sequence GCCGCCGCTGCCGCCGCTGCA) |
| HA3/5 |
Human Adenovirus Type 3/5 |
| HPRT |
Hypoxanthine phosphoribosyltransferase |
| IRES |
Internal ribosome entry site |
| loxP |
Locus of crossover in P1 |
| LTR |
Long terminal repeats |
| neo |
Neomycin resistance gene |
| pA |
Polyadenylation signal |
| pax2 |
Paired box gene 2 |
| PGK |
Phosphoglycerate kinase promoter |
| SA |
Splice acceptor |
| SD |
Splice donor |
| stop |
Translational stop codons |
| supF |
Suppressor tRNA gene |
| Venus |
Enhanced yellow fluorescent gene |